Review



zr 75 1 atcc atcc crl 1500 human  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    ATCC zr 75 1 atcc atcc crl 1500 human
    Zr 75 1 Atcc Atcc Crl 1500 Human, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1873 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/zr+75+1+atcc+atcc+crl+1500+human/ZR-75-1/pm41060805-226-67-68
    Average 97 stars, based on 1873 article reviews
    zr 75 1 atcc atcc crl 1500 human - by Bioz Stars, 2026-10
    97/100 stars

    Images

    Related Articles

    RNA Sequencing:

    Article Title: YEATS4 reads histone crotonylation to promote fatty acid metabolism and cancer cell stemness.
    Article Snippet: 1–25) peptide (ARTKQTARKSTGGK(hib)APRKQLATKAA) This paper N/A Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 First-Strand cDNA Synthesis SuperMix TransGen Biotech Cat# AT301 TIANamp Genomic DNA Kit Tiangen Biotech Cat# GDP304 Top Green qPCR SuperMix Tiangen Biotech Cat# AQ131 TaqPath ProAmp Thermo Fisher Scientific Cat# A30865 Lipofectamine 3000 Transfection Reagent Invitrogen Cat# L3000015 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat# 13778030 QIAquick PCR Purification Kit QIAGEN Cat# 28106 ALDEFLUOR Assay kit STEMCELL Cat# 01700 MammoCult Human Medium Kit STEMCELL Cat# 05260 ATP determination kit Invitrogen Cat# A22066 (Continued on next page) 20 Cell Reports 44, 116400, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data CUT&Tag This paper GEO: GSE256112 RNA-seq This paper GEO: GSE256110 Untargeted metabolomics This paper Metabolomics Workbench: ST003153 Source data This paper https://data.mendeley.com/ datasets/5bbp58tfdh/1 Experimental models: Cell lines Human: HEK293T ATCC ATCC CRL-3216; RRID:CVC_0063 Human: MCF-10A ATCC ATCC CRL-10317; RRID: CVCL_0598 Human: MCF-7 ATCC ATCC HTB-22; RRID: CVCL_0031 Human: T-47D ATCC ATCC HTB-133 Human: BT-474 ATCC ATCC HTB-20; RRID: CVCL_0179 Human: ZR-75-1 ATCC ATCC CRL-1500 Human: MDA-MB-468 ATCC ATCC HTB-132; RRID: CVCL_0419 Human: MDA-MB-231 ATCC ATCC HTB-26; RRID: CVCL_0062 Human: BT-549 ATCC ATCC HTB-122 Human: MDA-MB-436 ATCC ATCC CRL-2539; RRID: CVCL_0125 Experimental models: Organisms/strains BALB/c nude mice Peking University Health Science Center Department of Laboratory Animal Science N/A Oligonucleotides Human HBO1 siRNA#1: GAAATGCGCCTTCTTCTGA This paper N/A Human HBO1 siRNA#2: GGCTAAGCCAGAGTTCTCA This paper N/A Human HBO1 siRNA#3: GCTGTAACTCTCTAGGACA This paper N/A Huamn YEATS4 shRNA#1: GGGTGTTACTATCGTTAAACC This paper N/A Huamn YEATS4 shRNA#2: TGTAAGAATGGATGCTATA This paper N/A Primers for qChIP Table S2 N/A Primers for RT-qPCR Table S3 N/A Recombinant DNA pGEX-6P1-His-YEATS4 This paper N/A pcDNA3.1(− )-Vector This paper N/A pcDNA3.1(− )-3×FLAG-YEATS4 This paper N/A pLVX-IRES-Puro-Vector This paper N/A pLVX-IRES-Puro-3×FLAG-YEATS4-WT This paper N/A pLVX-IRES-Puro-3×FLAG-YEATS4-Y74A This paper N/A pLVX-IRES-Puro-3×FLAG-YEATS4-W93A This paper N/A pLVX-IRES-Neo-Vector This paper N/A pLVX-IRES-Neo-YEATS4-WT This paper N/A pLVX-IRES-Neo-YEATS4-Y74A This paper N/A pLVX-IRES-Neo-YEATS4-W93A This paper N/A pLVX-IRES-Neo-CD36 This paper N/A pLVX-IRES-Neo-CPT1A This paper N/A pLVX-IRES-Neo-ACOX1 This paper N/A pLKO.1-U6-shRNA2-puro-shControl This paper N/A (Continued on next page) Cell Reports 44, 116400, October 28, 2025 21 .. The cell lines used were obtained from the American Type Culture Collection (ATCC).

    Multiple Displacement Amplification:

    Article Title: YEATS4 reads histone crotonylation to promote fatty acid metabolism and cancer cell stemness.
    Article Snippet: 1–25) peptide (ARTKQTARKSTGGK(hib)APRKQLATKAA) This paper N/A Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 First-Strand cDNA Synthesis SuperMix TransGen Biotech Cat# AT301 TIANamp Genomic DNA Kit Tiangen Biotech Cat# GDP304 Top Green qPCR SuperMix Tiangen Biotech Cat# AQ131 TaqPath ProAmp Thermo Fisher Scientific Cat# A30865 Lipofectamine 3000 Transfection Reagent Invitrogen Cat# L3000015 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat# 13778030 QIAquick PCR Purification Kit QIAGEN Cat# 28106 ALDEFLUOR Assay kit STEMCELL Cat# 01700 MammoCult Human Medium Kit STEMCELL Cat# 05260 ATP determination kit Invitrogen Cat# A22066 (Continued on next page) 20 Cell Reports 44, 116400, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data CUT&Tag This paper GEO: GSE256112 RNA-seq This paper GEO: GSE256110 Untargeted metabolomics This paper Metabolomics Workbench: ST003153 Source data This paper https://data.mendeley.com/ datasets/5bbp58tfdh/1 Experimental models: Cell lines Human: HEK293T ATCC ATCC CRL-3216; RRID:CVC_0063 Human: MCF-10A ATCC ATCC CRL-10317; RRID: CVCL_0598 Human: MCF-7 ATCC ATCC HTB-22; RRID: CVCL_0031 Human: T-47D ATCC ATCC HTB-133 Human: BT-474 ATCC ATCC HTB-20; RRID: CVCL_0179 Human: ZR-75-1 ATCC ATCC CRL-1500 Human: MDA-MB-468 ATCC ATCC HTB-132; RRID: CVCL_0419 Human: MDA-MB-231 ATCC ATCC HTB-26; RRID: CVCL_0062 Human: BT-549 ATCC ATCC HTB-122 Human: MDA-MB-436 ATCC ATCC CRL-2539; RRID: CVCL_0125 Experimental models: Organisms/strains BALB/c nude mice Peking University Health Science Center Department of Laboratory Animal Science N/A Oligonucleotides Human HBO1 siRNA#1: GAAATGCGCCTTCTTCTGA This paper N/A Human HBO1 siRNA#2: GGCTAAGCCAGAGTTCTCA This paper N/A Human HBO1 siRNA#3: GCTGTAACTCTCTAGGACA This paper N/A Huamn YEATS4 shRNA#1: GGGTGTTACTATCGTTAAACC This paper N/A Huamn YEATS4 shRNA#2: TGTAAGAATGGATGCTATA This paper N/A Primers for qChIP Table S2 N/A Primers for RT-qPCR Table S3 N/A Recombinant DNA pGEX-6P1-His-YEATS4 This paper N/A pcDNA3.1(− )-Vector This paper N/A pcDNA3.1(− )-3×FLAG-YEATS4 This paper N/A pLVX-IRES-Puro-Vector This paper N/A pLVX-IRES-Puro-3×FLAG-YEATS4-WT This paper N/A pLVX-IRES-Puro-3×FLAG-YEATS4-Y74A This paper N/A pLVX-IRES-Puro-3×FLAG-YEATS4-W93A This paper N/A pLVX-IRES-Neo-Vector This paper N/A pLVX-IRES-Neo-YEATS4-WT This paper N/A pLVX-IRES-Neo-YEATS4-Y74A This paper N/A pLVX-IRES-Neo-YEATS4-W93A This paper N/A pLVX-IRES-Neo-CD36 This paper N/A pLVX-IRES-Neo-CPT1A This paper N/A pLVX-IRES-Neo-ACOX1 This paper N/A pLKO.1-U6-shRNA2-puro-shControl This paper N/A (Continued on next page) Cell Reports 44, 116400, October 28, 2025 21 .. The cell lines used were obtained from the American Type Culture Collection (ATCC).

    shRNA:

    Article Title: YEATS4 reads histone crotonylation to promote fatty acid metabolism and cancer cell stemness.
    Article Snippet: 1–25) peptide (ARTKQTARKSTGGK(hib)APRKQLATKAA) This paper N/A Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 First-Strand cDNA Synthesis SuperMix TransGen Biotech Cat# AT301 TIANamp Genomic DNA Kit Tiangen Biotech Cat# GDP304 Top Green qPCR SuperMix Tiangen Biotech Cat# AQ131 TaqPath ProAmp Thermo Fisher Scientific Cat# A30865 Lipofectamine 3000 Transfection Reagent Invitrogen Cat# L3000015 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat# 13778030 QIAquick PCR Purification Kit QIAGEN Cat# 28106 ALDEFLUOR Assay kit STEMCELL Cat# 01700 MammoCult Human Medium Kit STEMCELL Cat# 05260 ATP determination kit Invitrogen Cat# A22066 (Continued on next page) 20 Cell Reports 44, 116400, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data CUT&Tag This paper GEO: GSE256112 RNA-seq This paper GEO: GSE256110 Untargeted metabolomics This paper Metabolomics Workbench: ST003153 Source data This paper https://data.mendeley.com/ datasets/5bbp58tfdh/1 Experimental models: Cell lines Human: HEK293T ATCC ATCC CRL-3216; RRID:CVC_0063 Human: MCF-10A ATCC ATCC CRL-10317; RRID: CVCL_0598 Human: MCF-7 ATCC ATCC HTB-22; RRID: CVCL_0031 Human: T-47D ATCC ATCC HTB-133 Human: BT-474 ATCC ATCC HTB-20; RRID: CVCL_0179 Human: ZR-75-1 ATCC ATCC CRL-1500 Human: MDA-MB-468 ATCC ATCC HTB-132; RRID: CVCL_0419 Human: MDA-MB-231 ATCC ATCC HTB-26; RRID: CVCL_0062 Human: BT-549 ATCC ATCC HTB-122 Human: MDA-MB-436 ATCC ATCC CRL-2539; RRID: CVCL_0125 Experimental models: Organisms/strains BALB/c nude mice Peking University Health Science Center Department of Laboratory Animal Science N/A Oligonucleotides Human HBO1 siRNA#1: GAAATGCGCCTTCTTCTGA This paper N/A Human HBO1 siRNA#2: GGCTAAGCCAGAGTTCTCA This paper N/A Human HBO1 siRNA#3: GCTGTAACTCTCTAGGACA This paper N/A Huamn YEATS4 shRNA#1: GGGTGTTACTATCGTTAAACC This paper N/A Huamn YEATS4 shRNA#2: TGTAAGAATGGATGCTATA This paper N/A Primers for qChIP Table S2 N/A Primers for RT-qPCR Table S3 N/A Recombinant DNA pGEX-6P1-His-YEATS4 This paper N/A pcDNA3.1(− )-Vector This paper N/A pcDNA3.1(− )-3×FLAG-YEATS4 This paper N/A pLVX-IRES-Puro-Vector This paper N/A pLVX-IRES-Puro-3×FLAG-YEATS4-WT This paper N/A pLVX-IRES-Puro-3×FLAG-YEATS4-Y74A This paper N/A pLVX-IRES-Puro-3×FLAG-YEATS4-W93A This paper N/A pLVX-IRES-Neo-Vector This paper N/A pLVX-IRES-Neo-YEATS4-WT This paper N/A pLVX-IRES-Neo-YEATS4-Y74A This paper N/A pLVX-IRES-Neo-YEATS4-W93A This paper N/A pLVX-IRES-Neo-CD36 This paper N/A pLVX-IRES-Neo-CPT1A This paper N/A pLVX-IRES-Neo-ACOX1 This paper N/A pLKO.1-U6-shRNA2-puro-shControl This paper N/A (Continued on next page) Cell Reports 44, 116400, October 28, 2025 21 .. The cell lines used were obtained from the American Type Culture Collection (ATCC).

    Quantitative RT-PCR:

    Article Title: YEATS4 reads histone crotonylation to promote fatty acid metabolism and cancer cell stemness.
    Article Snippet: 1–25) peptide (ARTKQTARKSTGGK(hib)APRKQLATKAA) This paper N/A Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 First-Strand cDNA Synthesis SuperMix TransGen Biotech Cat# AT301 TIANamp Genomic DNA Kit Tiangen Biotech Cat# GDP304 Top Green qPCR SuperMix Tiangen Biotech Cat# AQ131 TaqPath ProAmp Thermo Fisher Scientific Cat# A30865 Lipofectamine 3000 Transfection Reagent Invitrogen Cat# L3000015 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat# 13778030 QIAquick PCR Purification Kit QIAGEN Cat# 28106 ALDEFLUOR Assay kit STEMCELL Cat# 01700 MammoCult Human Medium Kit STEMCELL Cat# 05260 ATP determination kit Invitrogen Cat# A22066 (Continued on next page) 20 Cell Reports 44, 116400, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data CUT&Tag This paper GEO: GSE256112 RNA-seq This paper GEO: GSE256110 Untargeted metabolomics This paper Metabolomics Workbench: ST003153 Source data This paper https://data.mendeley.com/ datasets/5bbp58tfdh/1 Experimental models: Cell lines Human: HEK293T ATCC ATCC CRL-3216; RRID:CVC_0063 Human: MCF-10A ATCC ATCC CRL-10317; RRID: CVCL_0598 Human: MCF-7 ATCC ATCC HTB-22; RRID: CVCL_0031 Human: T-47D ATCC ATCC HTB-133 Human: BT-474 ATCC ATCC HTB-20; RRID: CVCL_0179 Human: ZR-75-1 ATCC ATCC CRL-1500 Human: MDA-MB-468 ATCC ATCC HTB-132; RRID: CVCL_0419 Human: MDA-MB-231 ATCC ATCC HTB-26; RRID: CVCL_0062 Human: BT-549 ATCC ATCC HTB-122 Human: MDA-MB-436 ATCC ATCC CRL-2539; RRID: CVCL_0125 Experimental models: Organisms/strains BALB/c nude mice Peking University Health Science Center Department of Laboratory Animal Science N/A Oligonucleotides Human HBO1 siRNA#1: GAAATGCGCCTTCTTCTGA This paper N/A Human HBO1 siRNA#2: GGCTAAGCCAGAGTTCTCA This paper N/A Human HBO1 siRNA#3: GCTGTAACTCTCTAGGACA This paper N/A Huamn YEATS4 shRNA#1: GGGTGTTACTATCGTTAAACC This paper N/A Huamn YEATS4 shRNA#2: TGTAAGAATGGATGCTATA This paper N/A Primers for qChIP Table S2 N/A Primers for RT-qPCR Table S3 N/A Recombinant DNA pGEX-6P1-His-YEATS4 This paper N/A pcDNA3.1(− )-Vector This paper N/A pcDNA3.1(− )-3×FLAG-YEATS4 This paper N/A pLVX-IRES-Puro-Vector This paper N/A pLVX-IRES-Puro-3×FLAG-YEATS4-WT This paper N/A pLVX-IRES-Puro-3×FLAG-YEATS4-Y74A This paper N/A pLVX-IRES-Puro-3×FLAG-YEATS4-W93A This paper N/A pLVX-IRES-Neo-Vector This paper N/A pLVX-IRES-Neo-YEATS4-WT This paper N/A pLVX-IRES-Neo-YEATS4-Y74A This paper N/A pLVX-IRES-Neo-YEATS4-W93A This paper N/A pLVX-IRES-Neo-CD36 This paper N/A pLVX-IRES-Neo-CPT1A This paper N/A pLVX-IRES-Neo-ACOX1 This paper N/A pLKO.1-U6-shRNA2-puro-shControl This paper N/A (Continued on next page) Cell Reports 44, 116400, October 28, 2025 21 .. The cell lines used were obtained from the American Type Culture Collection (ATCC).

    Recombinant:

    Article Title: YEATS4 reads histone crotonylation to promote fatty acid metabolism and cancer cell stemness.
    Article Snippet: 1–25) peptide (ARTKQTARKSTGGK(hib)APRKQLATKAA) This paper N/A Critical commercial assays Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat# 23225 First-Strand cDNA Synthesis SuperMix TransGen Biotech Cat# AT301 TIANamp Genomic DNA Kit Tiangen Biotech Cat# GDP304 Top Green qPCR SuperMix Tiangen Biotech Cat# AQ131 TaqPath ProAmp Thermo Fisher Scientific Cat# A30865 Lipofectamine 3000 Transfection Reagent Invitrogen Cat# L3000015 Lipofectamine RNAiMAX Transfection Reagent Invitrogen Cat# 13778030 QIAquick PCR Purification Kit QIAGEN Cat# 28106 ALDEFLUOR Assay kit STEMCELL Cat# 01700 MammoCult Human Medium Kit STEMCELL Cat# 05260 ATP determination kit Invitrogen Cat# A22066 (Continued on next page) 20 Cell Reports 44, 116400, October 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data CUT&Tag This paper GEO: GSE256112 RNA-seq This paper GEO: GSE256110 Untargeted metabolomics This paper Metabolomics Workbench: ST003153 Source data This paper https://data.mendeley.com/ datasets/5bbp58tfdh/1 Experimental models: Cell lines Human: HEK293T ATCC ATCC CRL-3216; RRID:CVC_0063 Human: MCF-10A ATCC ATCC CRL-10317; RRID: CVCL_0598 Human: MCF-7 ATCC ATCC HTB-22; RRID: CVCL_0031 Human: T-47D ATCC ATCC HTB-133 Human: BT-474 ATCC ATCC HTB-20; RRID: CVCL_0179 Human: ZR-75-1 ATCC ATCC CRL-1500 Human: MDA-MB-468 ATCC ATCC HTB-132; RRID: CVCL_0419 Human: MDA-MB-231 ATCC ATCC HTB-26; RRID: CVCL_0062 Human: BT-549 ATCC ATCC HTB-122 Human: MDA-MB-436 ATCC ATCC CRL-2539; RRID: CVCL_0125 Experimental models: Organisms/strains BALB/c nude mice Peking University Health Science Center Department of Laboratory Animal Science N/A Oligonucleotides Human HBO1 siRNA#1: GAAATGCGCCTTCTTCTGA This paper N/A Human HBO1 siRNA#2: GGCTAAGCCAGAGTTCTCA This paper N/A Human HBO1 siRNA#3: GCTGTAACTCTCTAGGACA This paper N/A Huamn YEATS4 shRNA#1: GGGTGTTACTATCGTTAAACC This paper N/A Huamn YEATS4 shRNA#2: TGTAAGAATGGATGCTATA This paper N/A Primers for qChIP Table S2 N/A Primers for RT-qPCR Table S3 N/A Recombinant DNA pGEX-6P1-His-YEATS4 This paper N/A pcDNA3.1(− )-Vector This paper N/A pcDNA3.1(− )-3×FLAG-YEATS4 This paper N/A pLVX-IRES-Puro-Vector This paper N/A pLVX-IRES-Puro-3×FLAG-YEATS4-WT This paper N/A pLVX-IRES-Puro-3×FLAG-YEATS4-Y74A This paper N/A pLVX-IRES-Puro-3×FLAG-YEATS4-W93A This paper N/A pLVX-IRES-Neo-Vector This paper N/A pLVX-IRES-Neo-YEATS4-WT This paper N/A pLVX-IRES-Neo-YEATS4-Y74A This paper N/A pLVX-IRES-Neo-YEATS4-W93A This paper N/A pLVX-IRES-Neo-CD36 This paper N/A pLVX-IRES-Neo-CPT1A This paper N/A pLVX-IRES-Neo-ACOX1 This paper N/A pLKO.1-U6-shRNA2-puro-shControl This paper N/A (Continued on next page) Cell Reports 44, 116400, October 28, 2025 21 .. The cell lines used were obtained from the American Type Culture Collection (ATCC).



    Similar Products

    zr 75 1 atcc atcc crl 1500 human  (ATCC)
    97
    ATCC zr 75 1 atcc atcc crl 1500 human
    Zr 75 1 Atcc Atcc Crl 1500 Human, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/zr+75+1+atcc+atcc+crl+1500+human/ZR-75-1/pm41060805-226-67-68
    Average 97 stars, based on 1 article reviews
    zr 75 1 atcc atcc crl 1500 human - by Bioz Stars, 2026-10
    97/100 stars
    		  Buy from Supplier
    zr 75 1 atcc crl 1500 human  (ATCC)
    97
    ATCC zr 75 1 atcc crl 1500 human
    Zr 75 1 Atcc Crl 1500 Human, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/zr+75+1+atcc+atcc+crl+1500+human/ZR-75-1/pmc11647209__can___24___0800_supplementary_data_suppsd-61-29-30
    Average 97 stars, based on 1 article reviews
    zr 75 1 atcc crl 1500 human - by Bioz Stars, 2026-10
    97/100 stars
    		  Buy from Supplier
    human breast carcinoma zr 75  (ATCC)
    95
    ATCC human breast carcinoma zr 75
    Human Breast Carcinoma Zr 75, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/zr+75+1+atcc+atcc+crl+1500+human/ZR-75-1%3B+Breast+Carcinoma%3B+Human/pmc11029653-85-0-12
    Average 95 stars, based on 1 article reviews
    human breast carcinoma zr 75 - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    atcc crl  (ATCC)
    95
    ATCC atcc crl
    Atcc Crl, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/zr+75+1+atcc+atcc+crl+1500+human/ZR-75-1%3B+Breast+Carcinoma%3B+Human/pmc08919295__mmc1-28-94-94
    Average 95 stars, based on 1 article reviews
    atcc crl - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    human zr 75 1  (ATCC)
    95
    ATCC human zr 75 1
    Human Zr 75 1, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/zr+75+1+atcc+atcc+crl+1500+human/ZR-75-1%3B+Breast+Carcinoma%3B+Human/pm30903103-37-0-9
    Average 95 stars, based on 1 article reviews
    human zr 75 1 - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    human zr 75 1 breast carcinoma cells  (ATCC)
    95
    ATCC human zr 75 1 breast carcinoma cells
    Human Zr 75 1 Breast Carcinoma Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/zr+75+1+atcc+atcc+crl+1500+human/ZR-75-1%3B+Breast+Carcinoma%3B+Human/pmc07559243__mmc1-2-0-5
    Average 95 stars, based on 1 article reviews
    human zr 75 1 breast carcinoma cells - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    human breast cancer cell lines  (ATCC)
    95
    ATCC human breast cancer cell lines
    Human Breast Cancer Cell Lines, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/zr+75+1+atcc+atcc+crl+1500+human/ZR-75-1%3B+Breast+Carcinoma%3B+Human/pmc07881808-64-4-11
    Average 95 stars, based on 1 article reviews
    human breast cancer cell lines - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    zr75b  (ATCC)
    95
    ATCC zr75b
    KEY RESOURCES TABLE
    Zr75b, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/zr+75+1+atcc+atcc+crl+1500+human/ZR-75-1%3B+Breast+Carcinoma%3B+Human/pmc07085414-42-0-2
    Average 95 stars, based on 1 article reviews
    zr75b - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Cell reports

    Article Title: MYC Dysregulates Mitosis, Revealing Cancer Vulnerabilities

    doi: 10.1016/j.celrep.2020.02.041

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: ZR75B , ATCC , CRL-1500.

    Techniques: Recombinant, Viability Assay, Staining, DNA Purification, RNA Sequencing, Gene Expression, shRNA, Plasmid Preparation, Software